*Corresponding author. Email: [email protected] eISSN: 2550 - 2166 / © 2018 The Authors. Published by Rynnye Lyan Resources Food Research 3 (1) : 28 - 39 (February 2019) Journal homepage: http://www.myfoodresearch.com FULL PAPER Prevalence and antibiotic profile of Shiga - toxin producing Escherichia coli and Escherichia coli O157: H7 in beef and buffalo 1,* Kwan, S.Y., 1 Chang, W.S., 1 Loo, Y.Y., 1 Nordin, Y., 1 Tan, C.W., 2 Kuan, C.H., 1 New, C.Y., 1 Lee, E., 1 Nor - Khaizura, M.A.R. and 1,3 Son, R. 1 Department of Food Science, Faculty of Food Science and Technology, Universiti Putra Malaysia, 43400, Serdang, Selangor, Malaysia 2 Department of Agriculture and Food Science, Faculty of Science, Universiti Tunku Abdul Rahman (UTAR), Jalan Universiti, Bandar Barat, 31900 Kampar Perak, Malaysia 3 Food Safety and Food Integrity, Institute of Tropical Agriculture and Food Security, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia Article history: Received: 28 July 2018 Received in revised form: 26 August 2018 Accepted: 28 August 2018 Available Online: 9 September 2018 Keywords: Shiga - toxin producing E. coli, E. coli O157: H7, Antibiotic Susceptibility, Polymerase Chain Reaction (PCR), Disk Diffusion Test 29 Kwan et al. / Food Research 3 (1) (2019) 28 - 39 eISSN: 2550 - 2166 © 2018 The Authors. Published by Rynnye Lyan Resources from the feces of contaminated cows, water sources, insects and also wild birds (Vogeleer et al ., 2014). The mode of transmission of Shiga - toxin producing E. coli to human is first via food which is the major vehicle of transmission. Undercooked ground beef is the most common vehicle for transmitting Shiga - toxin producing E. coli infection (Jay et al ., 2004). Other than the transmission via food, direct contact with the infected animal is another mode of transmission. Humans that directly contact with infected farm animals or the contaminated environment will eventually cause Shiga - toxin producing E. coli infection on themselves. Two or more people experiencing the same illness after consuming the same contaminated food or drinks is named a foodborne disease outbreak (CDC, 2011). There are several strains of E. coli can cause diarrhea and severe illness to human. E. coli is used as a faecal indicator organism (DES, 2003). The presence of E. coli in food indicates faecal contamination. E. coli should have less than twenty colony - forming unit (CFU) / gram in ready to eat food in order to achieve the satisfactory standard for hygiene (CFS, 2009). Antibiotics or the antibacterial are the antimicrobial drugs which are used for the treatment or the prevention of infection caused by bacteria. There are several sites of attack for different types of antibiotics. Both penicillin and cephalosporins work by preventing the formation of cell wall, while macrolides, fluoroquinolones and sulphonamides work by preventing the formation of protein, nucleic acid and interruption of metabolism process of bacteria (Pham, 2012). As time passed, more antibiotics were found and introduced to treat certain infection. Yet, the more the antibiotics, the higher chances of exposure for certain bacteria towards these antibiotics. Vigorous usage of antibiotics results in more resistant bacteria over time. Antibiotic resistance is a situation where bacteria had changed its response towards the use of medicines (WHO, 2016a). From the literature of medical, a drug - resistant bacteria was isolated since the 1970s from a dairy cattle (Sharma, 2017). There were at least 2 million people who were infected with these antibiotics resistant bacteria each year and 23000 people died due to this infection (CDC, 2017b). Infections caused by the antibiotic - resistant bacteria are more difficult to cure. The treatment can be costlier or use a toxic alternative. Antibiotic resistance Kwan et al. / Food Research 3 (1) (2019) 28 - 39 30 eISSN: 2550 - 2166 © 2018 The Authors. Published by Rynnye Lyan Resources Reaction (PCR) analysis. 2.3 Enumeration of Escherichia coli Approximately, one mL of the stomached fluid was added with 9 mL of TSB tubes, to obtain10 - 2 dilution. Dilutions were made up to 10 - 9 . An amount of 100 μ L of each dilution was pipetted and spread onto Eosin Methylene Blue (EMB) Agar. The plates were incubated in the incubator for 24 hours at 37°C (FDA, 2002). 2.4 DNA extraction Approximately, one mL was aliquoted from the MPN positive tubes, indicated by turbidity, into 1.5 mL microcentrifuge tubes and centrifuged at 12,000 rpm for 3 mins. The supernatant was discarded and re - suspended with 200 μ L of TE buffer. The suspension mixture in the tubes were then boiled at 100°C for 10 mins. The boiled mixture was immediately cooled at - 20°C for 10 mins. Lastly, centrifuged at 12,000 rpm for 5 mins and stored in freezer at – 20°C (Chang et al. , 2013). 2.5 Multiplex Polymerase Chain Reaction (PCR) Shiga - toxin genes ( stx 1 and stx 2), fliCh7 gene and rfbO157 gene of stx1 - F (5’ - ATAAATCGCCATTCGTTGACTAC - 3 ’), stx1 - R (5’ - AGAACGCCCACTGAGATCATC - 3 ’), stx2 - F (5’ - GGCACTGTCTGAAACTGCTCC - 3 ’) 31 Kwan et al. / Food Research 3 (1) (2019) 28 - 39 eISSN: 2550 - 2166 © 2018 The Authors. Published by Rynnye Lyan Resources representing the stx 1 gene and stx 2 gene respectively. Figures 1 and 2 shows the results of PCR amplified products indicating the presence of E. coli O157: H7 and Shiga - toxin producing E. coli . ATCC 43895 was used as the positive control. Among 108 samples, a total of twenty - one samples were found present with either a single stx 2 gene or with both stx 1 and stx 2 genes. None of the samples were found present with only a single stx 1 gene. However, most of the samples were found present with only stx 2 gene, which reached a percentage as high as 85.7% (nine samples from local beef; nine samples from Indian buffalo). The rest of the positive samples were found present with both stx 1 and stx 2 gene which was 14.3% (one sample from local beef; two samples from Indian buffalo). It was found that, eight samples (7.41%) were contaminated with E. coli O157: H7, where five samples were from local beef and three samples were from Indian buffalo. On the other hand, Shiga - toxin producing E. coli was detected in a higher percentage when compared to E. coli O157: H7. There were thirteen samples (12.04%) detected with the presence of Shiga - toxin producing E. coli , whereby five samples were from local beef and eight samples were from Indian buffalo. The microbial load of E. coli O157: H7 in the 108 samples fell between the range of < 3 MPN/g to 9.4 MPN/g while the microbial load of Shiga - toxin producing E. coli was between < 3 MPN/g to > 1100 Kwan et al. / Food Research 3 (1) (2019) 28 - 39 32 eISSN: 2550 - 2166 © 2018 The Authors. Published by Rynnye Lyan Resources beef and Indian buffalo, where six of them were Shiga - toxin producing E. coli positive, while the rest were E. coli O157: H7 positive. Tables 1 and 2 show the susceptibility of all isolates toward different antibiotics. Shiga - toxin producing E. coli isolates showed highest susceptibility towards ceftazidime (100%), followed by moxifloxacin (83.33%), sulphamethoxazole (66.67%), ampicillin (50%), amoxycillin (50%), ciprofloxacin (50%), erythromycin (33.33%) and penicillin G (33.33%). On the other hand, for E. coli O157: H7 isolates showed highest susceptibility towards erythromycin (100%), ceftazidime (100%), ciprofloxacin (100%) and moxifloxacin (100%), followed by sulphamethoxazole (60%), ampicillin (20%), amoxycillin (20%), and penicillin G (0%). Both erythromycin and penicillin G standard were not found in the Performance Standards for Antimicrobial Susceptibility Testing guideline. However, two Shiga - toxin producing E. coli isolates had showed susceptible towards erythromycin, giving a susceptibility range of 20 mm and 12 mm. Two Shiga - toxin producing E. coli isolates showed susceptible towards penicillin G, with the susceptibility range of 9 mm and 12 mm. Moving to E. coli O157: H7 isolates, all of the isolates showed no resistant towards erythromycin with susceptibility range from 10 mm to 23 mm. However, all of the isolates from E. coli O157: H7 were resistant to penicillin G. Multiple antibiotics resistance (MAR) index and the resistant pattern of each isolates were recorded and analyzed. Most of the isolates showed their resistance towards more than one antibiotics. Since erythromycin and penicillin G were not recorded in the guidelines of Performance Standards for Antimicrobial Susceptibility Testing handbook, the zone of susceptibility appeared on plate will then be considered as resistant towards that specific antibiotic. Table 3 shows the antibiotics resistance pattern and the multiple antibiotics resistance index of Shiga - toxin producing E. coli and E. coli O157: H7 from local beef and Indian buffalo. 4. Discussion